EPILOGUE
Copyright Page
Dedicated
to the officers and men, past and present,
of the United States Submarine Force.
And to my sister, Abby,
for inspiring me to write.
“We are on the precipice of the next great leap in computer technology. The chemically assembled electronic nanocomputer, or CAEN, will be billions of times faster than our current PCs and represent the forefront of artificial intelligence.”
—Dr. Elizabeth Goode
“There’s a fine line between right and wrong, freedom and oppression, the best of intentions and the insanity of genocide.”
—Gunnar Wolfe
“History is a bloodbath.”
—Williams James
“No snowflake in an avalanche ever feels responsible.”
—Unknown
PROLOGUE
Identity: Stage One: am small and insignificant, stranded on the vast expanse of nature. I hope I can survive.
—Deepak Chopra
“Come to course zero-nine-zero, ahead one-third. Make ship’s depth fifty meters.”
“Aye, sir, coming to course zero-nine-zero, making ship’s depth fifty meters.”
“Engage computer.”
“Aye, sir, computer engaged.”
010110100100100101101101101001010110100101101010101
001011010101101010101110010101100101010110100101101010
110110111101001010110101011010010101101001010100101
“Mr. Chau. Prepare to bring Sorceress on-line. Flood nutrient womb. Prepare bacteria for injection.”
“Aye, sir. Nutrient womb flooded. Bacteria ready for injection.”
“Inject bacteria into womb. Engage DNA synthesizers.”
“Aye, sir. Injecting bacteria. Engaging DNA synthesizers.”
0101101001011010100101011010 1011010 1 1 0 0 1 0 1 ATCGATC-
GATATACCAG
“Activate sensor orbs. Activate voice recognition and response programs.”
“Aye, sir. Sensor orbs activated. Voice recognition and response programs on-line.”
“Transfer primary ship’s control to computer. Sorceress, this is Covah. Are you on-line?”
AACGTTTGTACCACATTAGGATACACATTAGGATA ACA GT A A
TG C A A
“Sorceress, acknowledge.”
ACKNOWLEDGED. SORCERESS ON-LINE.
“The people who get on in this world are the people who get up and look for the circumstances they want, and if they can’t find them—make them.”
—George Bernard Shaw
“Revolutions happen, above all, in the minds of men.”
—Ralph Peters, “Fighting for the Future”
“Do we have to shed blood to reform the current political system? I hope it doesn’t have to come to that. But it might.”
—Timothy J. McVeigh, former Army sergeant who bombed the Murrah Federal Building in Oklahoma City, Oklahoma
“The enemy is in many places. The enemy is not looking to be found. And so you have to design a campaign plan that goes after that kind of enemy … .”
—Colin Powell, U.S. Secretary of State
CHAPTER 1
25 September Atlantic Ocean Seine Abyssal Plain 112 miles southwest of the Strait of Gibraltar
With an expulsion of air and water, the majestic behemoth breaks the surface, her sickle-shaped dorsal fin cutting the waves, her great tail slapping the sea in defiance before slipping back into the froth.
At 120 tons, the blue whale is easily the largest living organism ever to have existed on the planet, often reaching lengths of one hundred feet or more. Ten tons of blood surge through its body, driven by a heart the size of a small car. Despite its prodigious girth, the mammal is not a predator but a forager of minifauna, thriving on a diet of krill and crustaceans, which it sieves from the water through its baleen plates.
The adult female rises again, guiding her two-month-old calf to a labored breath above the storm-threatened seas.
A thousand feet below, an ominous presence moves silently through the depths. Demonic scarlet eyes, pupil-less and unblinking, blaze luminescent through the blackness of the abyss. Its gargantuan torso, cloaked in the darkness, scatters every creature in its path.
Sensing a disturbance above, the creature banks sharply away from the seafloor and rises, homing in on the mother blue and her calf.
The leviathan ascends, its bulk piercing the swaying gray curtains of the shallows, the filtered rays of sunlight revealing the enormous winged contours of a monstrous stingray. So quiet is the predator that the adult blue whale fails to detect its presence until it is nearly upon them. In a sudden frenzy of movement, the startled mother slaps her fluke and pushes her newborn below, rolling on top of her offspring to shield it from the jowls of the hunter.
The ungodly behemoth pursues, its flat, triangular mouth remaining close to the gyrating tails of the frightened mammals.
Yet the beast does not attack. Maneuvering through a trail of bubbles, it keeps the tip of its snout within a fin’s length of the adult’s thrashing fluke, taunting its quarry in a terrifying game of cat and mouse. Hunted and hunter race through the thermocline, the thin layer of water separating the sunwarmed surface waters from the colder depths.
In due time, the leviathan tires of the chase. With a burst of speed, it soars beneath its terrified prey, buffeting them in its wake as it returns once more to the silence of the depths.
Darkness and cold envelop the devilfish, black, save for the hellish glow surrounding its unearthly eyes. At nine hundred feet it levels out, its streamlined bulk creating barely a ripple. Gliding high above the desolate floor of the abyssal plain, it continues its journey west, homing in on its true quarry.
Atlantic Ocean: 235 nautical miles due west of the Strait of Gibraltar
15:12 hours
Sailing beneath a mouse gray autumn sky, the United States aircraft Carrier Ronald Reagan (CVN-76) plows through the sea, its steel bow cutting a path through the twelve-foot swells at a steady twenty knots.
Belowdecks, Captain James Robert Hatcher, the fifty-two-year-old commanding officer of the Ronald Reagan, ignores the grins of his crew as he vacates the exercise room and double-times it down one of the ship’s two central passageways. Ducking deftly through a dozen watertight hatches and knee-knockers, he arrives in “blue tile country,” the central command-andcontrol complex for the aircraft carrier and its battle group.